《M-chan Wars: Rise and Fall of the Cat Tyrant》Chapter 14: Raining CATs on dogs
Advertisement
- Memory log 2: MG Simba -
As I expected. Without the technical support from M-chan servers, our forces are sitting ducks out there. Even with our Dere-powered forces are no match for the eccentricities of the sci-fi universe.
Even our aerial forces cannot match the Nyaacats that have been deployed. Only if we had access to our underground bunkers of BT Dark Technologies. With no doubt then, we will be able to retake the mainland and murder a Cat repeatedly with no effort at all.
Unfortunately, that is not an option I have at the moment. With the 4,000 troops just arriving, I'm having them prepare for our new strategy for moving through the enemy lines in order to infiltrate the massive compound before us.
*BEEP* *BEEP* *BEEP*
"What's with that beeping?!"
"Sir! It's the radar! It's detecting strange abnormalities coming from the statue!"
"Is it now? Can you tell me more?"
"Sir. It's nothing I have seen before. I can't..."
"Incompetence! I will take a look myself!"
Stepping out of the Command Post, I looked in the direction of the CAT Church and Oppai statue that now blocked the rising morning sun behind it. Suddenly, several booms of loud cannon fire can be heard from the Oppai statue.
Moments later, I notice several small metal balls flying in the direction of our base. As it came closer, it became bigger and bigger till it looked like some giant metal pillar.
"RAISE THE ALARMS!!!! WE ARE UNDER ATTACK!" I hollered as our onlooking troops sprung into action.
From what I could see, it was a matter of seconds before the first of those "things" landed. Realising one was targeted right at our Command Post, I jumped to the side just to get out of its path, with it crushing the tentage behind me.
As I got back up on my feet, a section of the pillar opened up, revealing a company of CATs that were stuffed into it. As the CATs streamed out of the pillar, I took off my coat and grabbed my handgun.
Backing in the direction that I remember to be the armoury, I fired a few shots at them. With the chaos of battle now brought directly to us, there is no longer any capability of command left to bog me down.
"GENTLEMEN! It's time for battle."
- End of memory log 2: MG Simba -
-----------------------------------------------------------------------------------------------------------------------
- Memory log 2: LTC Aiel -
"So..." says CPT Kaiki while rolling towards me on his chair, "any other performance you require of me? Want me to act like your bitch over there next?"
"No. That will be enough for now. Take him down to his cell. I think we will be seeing the last of you for a while now."
Spitting in a disgruntled manner, CPT Kaiki stays on his chair as the guards handcuffs him before bringing him out of the Command Room. As our staff resume their positions, MAJ Yuno creeps up from behind, giving me a surprise hug.
"Dar-ling~. Did I do well again today~?" she whispers into my ear while weighing down on my shoulders with her arms.
"Ahem. Yuno. There's a time and place for everything. And speaking of which, did you disobey my order by leaving your position?"
"Erhhh~but then the baddie would have gotten you. Trap you and slowly...slowly torture you..."
Advertisement
"Maybe. Erm. Good work anyway. But next time, please don't do it again."
"Whatever you say, darling~!" as she releases her arms, allowing me to have breathe in relative safety again.
Turning around, SSG Tony looks up to me with the hint of a smirk, but straightens up before beginning to speak.
"Sir. Is this really a good idea?"
"Well, at this point, everything in the message is true to the finest detail. Even now when we lost contact with Frontline HQ and MG Simba."
"But the encrypted message did come from CAT High Command. Unless we have a snitch, it's unlikely for our covert forces to have made it into such a position, isn't it?"
"This is a highly abnormal scenario. As such, going by one's instincts would probably do a lot more good than anything else."
"Mhmm...just like deciding to meet with a captive traitor directly?" adds MAJ Yuno from my side.
"T-That was it too!"
"And if I didn't decide to follow you, you would have escaped safely and be back in command now?"
"I would have! ...eventually."
Giving me a smile with a hint of murderous intent, I finally gave up on arguing and pat her on her head.
"All right. You did a great job. Now we have a job to do as well. Let's give the Cat a jab it never expected."
- End of memory log 2: LTC Aiel -
-----------------------------------------------------------------------------------------------------------------------
- Memory log 4: 2LT Redshirt -
"CAPTAIN! MISS HATSUKO!" were the words I attempt to shout as CPT (CAT) Angel fires his ultimate attack, NYAA~CALIBUR.
As a bright light filled the area, the last thing I saw was CPT Christian move in a flash from his kneeling position to standing in front of MRC DarkCloud. As the light became too bright for me to bear, I perform a 180 twist into a squatting position in order to protect my eyes.
Keeping my eyes shut, I waited for a few moments till the light no longer shines through my eyelids. Resuming my previous stance, I looked to see what happened to the Captain and Miss Hatsuko.
CPT Christian remained in his standing posture for about two seconds before falling forward as he spews a rainbow coloured stream from his mouth. Hitting the ground, a pool of rainbow coloured liquid formed around him. As MRC DarkCloud took a step back, CPT (CAT) Angel begins to speak.
"Behold, my innocent will. G-Rated."
"What...?!" replies MRC DarkCloud as she raised an eyebrow.
"Isn't the wonders of censorship and family friendly entertainment just so moe~~~ That is my special ability, G-Rated."
"Soon this will become EXTREMELY R-Rated!" shouts MRC DarkCloud as she kicks the body of CPT Christian, sending him flying at CPT (CAT) Angel.
Raising his sword, CPT (CAT) Angel cuts CPT Christian into two, causing an unexplainable amount of candy to burst from his body.
"Isn’t this just poi-" says CPT (CAT) Angel before he is interrupted by a series of explosions from explosive kunais thrown by MRC DarkCloud.
"RED! NADES NOW!" she shouts as she runs in the direction of her mace that she had dropped earlier.
Grabbing a Catnipade, I fling it at CPT (CAT) Angel, causing a gas cloud of catnip to form around him. As CPT Christian was defeated, his domain finally lost form as cracks filled the area rapidly.
Advertisement
Reaching her mace, MRC DarkCloud lifts it up with some effort as her exoskeleton suit sparked dangerously. Realising the gas cloud should have moderately dissipated by now, I returned my focus to CPT (CAT) Angel, who was in the middle of raising his sword high for some attack.
Raising my rifle, I fired at his arm to no avail. Fortunately, a stray round landed on his sword that appeared to disrupt his attack, causing him to twitch his CAT ears in anger. Having bought MRC DarkCloud some time, she now stood before the enemy CAT, swinging her mace upwards.
As the giant spiked mace smashed against the side of CPT (CAT) Angel, MRC DarkCloud draws a hidden blade from her utility belt and throws it into Senkattou's vicious grinding blades. Triggering some form of hidden mechanism, MRC DarkCloud jumps backwards to narrowly escape a direct blast as both her weapons exploded.
Blown back by the force, she flew several metres, tumbling over the ground at least five times as her exoskeleton broke off in a few places. CPT (CAT) Angel, for some reason, was also blown away in the opposite direction into the sky.
As he flew into the cracked skies of CPT Christian's collapsing domain, the world finally breaks down and we are returned to our previous location before the Church.
With our remaining enemy sent flying, CPT Christian's body pieces itself back together as it returns to a realistic bloodied form. Looking over to MRC DarkCloud, she has already gotten back up despite clearly having taken significant damage as she wobbled on her feet with her exoskeleton making loud straining noises.
Before I could run over to assist her, a blob falling from the sky above lands a few metres away, splattering some white substance around the place. As the two of us stared at the spot of where the blob landed, I realised a bunch of small unusual shadows over the area around us. Looking upwards, I see a few smaller blobs falling from above.
"Miss Hatsuko! Watch out!" was the only thing I could shout as MRC DarkCloud throws an explosive kunai upwards, causing an explosion that sends the blob splattering all over the place, with a few drops landing on me.
Running over to check on her safety, I stopped a metre away from her as she kneels on ground with her calves forming a V shape. As the explosion only stopped so much of the large blob from landing directly on her, the remainder has splattered over various parts of her body.
Forgetting myself, I gazed at the awkwardly erotic sight before me till a murderous aura causes me to veer my head to the side in fear.
Shivering in anger, she breathes in deeply before shouting, "HHHHHHHHHHHHIIIIIIIIIIIIIIIIIIITTTTAAAAAAGGGGGGGGGGIIIIIIIIIIIII!!!!!!!!!!!!!!"
- User initiated log completion -
- End of memory log 4: 2LT Redshirt -
-----------------------------------------------------------------------------------------------------------------------
- Memory log 2: SC Simon -
"LIEUTENANT!"
Warding off another strike of Vicious Blades from GEN (CAT) Nathanael, I turn my attention to 1LT Mark who was just sent flying due to a missile blast. However, the enemy before me wasn’t one who I could treat lightly, taking advantage of my momentary drop in guard to close in, unleashing the fury of another combo upon me.
"Simon. You have weakened. Has the years of being a NEET finally get to that physique of yours, or perhaps it's the Fast Food nature of an Otaku?"
"S-SHUT UP! You are no better, falling to the dark side within the dark side of Baka Tsuki!"
"Silence! The darkness has always been my calling. On the contrary, you are the one faking his darkness while basking in the light!"
"You do not even make sense anymore. Where has your love for pure Light Novels gone to!"
Stretching my arms backward, I thrust my fists forward together at GEN (CAT) Nathanael. As he jumps backward in a futile attempt to dodge my attack, I released my fist and slap my palms together, producing a windlash that sends him flying a mile away.
Turning around, I strained my eyes as I looked through the chaotic battlefield for signs of Mark or his yandere squad.
"LEADER! BEHIND YOU!" comes from a direction from left as a warning of an attack.
Jumping 50 feet into the air, I evade the sneak attack from GEN Nathanael. In response to my escape, Nathanael follows up with a special attack that I recognise to be Blade Tornado, a move that he completed after our joint training on Mount Erosica. Unable to move in mid air, his attack hits me head on in its endless slashes, causing me to slowly lose strength as I faint.
"That is as far as the great leader of M-chan goes, huh."
At this moment, a missile explodes behind him. Looking beneath me, I saw a girl swinging skillfully around a CAT mecha, causing it to misfire at specific locations. A sense of inspiration surged through my mind. Tightening my muscles, I let out a hearty roar, negating Blade Tornado.
"This will be your shortcoming, NATH!" I shouted as I fall through the air, preparing for a groundbreaking move.
Realising my intent, GEN (CAT) Nathanael leaps upwards using his ultimate defensive move, Eternal Sword Barrier.
"ADDDMMMMMMIIIIIINNNNNNNNN JUSTICE!!!!!"
"ETERNAL SWORDS! BARRIER GUARD!!!"
In an epic collision, the two of us exchanged an infinite number of blows within the frame of a standard television animation. With my superior might prevailing, I finally deal a straight punch as the frame progressed to the next. Sending GEN (CAT) Nathanael into the ground, I land with a soft step.
"Nathanael. These wounds you have dealt will be the scars I carry. Let this be the reminder of the bond we share." I say as a hundred small cuts appears slowly over my body.
With the CAT mecha from earlier finally collapsing to the ground, the girl who I recognise to be a yandere soldier and an unknown male Alliance Officer runs towards me.
"Sir! This is 1LT Jonathan! Are you all right?"
"Jonathan, is it. I'm fine. More importantly, I see you have attained the ability to control a Yandere's true power."
"Thank you, Sir! But what of the enemy you were battling against earlier?"
"Escaped, it seems." as I glance over to the now empty hole in the ground where I sent GEN (CAT) Nathanael flying to.
Suddenly, several loud cannon blasts resound from the Oppai goddess behind me. Watching in horror as several large pillars flew in the direction of our Frontline base, I knew the enemy has become deadly serious.
"Lieutenant! Another squad led by 1LT Mark was split up in this area. I order you to regroup with them before retreating to base. I will dispose of these menaces."
Not giving him a chance to reply, I leap forward at the nearest CAT contraption, letting out a roar of manliness.
- End of memory log 2: SC Simon -
Advertisement
- In Serial392 Chapters
Transdimensional Marketing
I am merely a reviewer, albeit the products I review are slightly different. For example, I review quantum computers, artificial intelligence, anti-gravity mech armor, planetary engines, sublight colonial ships, stellar detonators, etc… Chen Yu: “The technological product I bring to everyone for today’s episode is—a dual-vector foil! W-Wait! Everyone, please calm down! Let me explain…”
8 1088 - In Serial23 Chapters
The Most Overpowered Floofer
Petey, a Golden Retriever from Earth with a heart equally golden, was euthanized in a pound after over twelve years of love to everyone he met. Thankfully, a few very powerful people seem to agree that it seemed unfair, and gave him a chance to live life to the fullest in another world. Oh, and they gave him just a few perks... Okay, maybe a lot of perks.
8 275 - In Serial32 Chapters
All The Skills - A Deckbuilding LitRPG
In a world where all magical spells have been captured into cards, those who can build a deck have the most power. The most Arthur could ever hope for was to someday earn a trash-tier spell card. When fate grants him a legendary Master of Skills card, he's thrust into a world of opportunity and danger. To survive and grow strong, Arthur must learn skills. All the skills.
8 252 - In Serial28 Chapters
High school life in a world where everyone has superpowers
So, um... how do I explain this simply? Okay, so... There's a girl, she's er... She's in high school, and, um... She has a superpower that mutes things? Also she lives? Yeah, sorry. The concept's too confusing isn't it? Warning: The stuff below is technically correct, but this fiction, with my other, is now on the failed pledge list. Shocking how a lack of updates for more than half a year actually meant something... Sorry for the delay, still not really up to writing for this series as of now (14/03/18 - remember I'm english, so correct) but I'm still trying to get into writing... Cover is thanks to Zenlith (WriTE's Founding Member). This fiction is signed under the 'The Pledge'... Some internet message in a forum about not dropping or giving a rushed ending in their fiction, otherwise meet the wrath of letting RRL mod Vocaloid have 'fun' with the fiction's description. So mainly for the sake of my fiction due to said wrath, I'll see this fiction through. Updates: up in the air... hopefully the day after this is edited, but we all have dreams. Warning for mild profanity, but it shouldn't happen too much for the innocent out there so don't take the warning to heart.
8 173 - In Serial10 Chapters
Fableman
People say that if Charlie Pratt had a penny for every blunder, he'd fill his pockets and then misplace his trousers.When Charlie tries to learn more about Dalia Addair, the peculiar girl who lives in the haunted manor on the edge of town, he accidentally slots himself into her magical trial—a trial that she has spent her whole life preparing for; he gets a day.But something's wrong; the trial is unleashing monsters that haven't been seen for centuries, and powerful forces are determined to stop them at any cost.Without knowing whom they can trust, Dalia and Charlie must work together to survive, and finish the trials, if they don't strangle each other first.A Quirky and fast-paced magical academy story that proves how even the most unlikely of heroes will step forward... when there's a ten-foot troll screaming after him.
8 164 - In Serial39 Chapters
siyari.
𝗍𝗁𝖾 𝗅𝗂𝖿𝖾 𝗈𝖿 𝗌𝗂𝗒𝖺𝗋𝗂.
8 90

