《On the Edge of Eureka》Codice Cipher
Advertisement
Lyra felt as if she was emerging from a fever dream. Walking through these labyrinthine hallways and vacuous, empty rooms, she was deeply uncomfortable, but she couldn’t put her finger on why. It gave her the same mix of emotions as empty spaceports, abandoned parking lots, education centers while the students were on break—unease, mild dissatisfaction, and the general feeling that something was wrong. But all three of the above examples, she could attribute to kenopsia; of course she felt uncomfortable standing alone in places that were normally filled with people. Besides, she was a Cantator, and she generally wasn’t supposed to be in carports or education centers anyway. Her uneasiness with the Terminal was harder to pin down, though—she’d never seen this place as anything other than a burnt-out shell of a once-great museum, so why did she miss its glory days? How could she feel nostalgic for a time she’d never lived through?
The appearance of her surroundings wasn’t helping matters, either. Everything was washed-out organic white, so Acidalia’s blood dripping onto the floors stood out starkly, making her injuries much more noticeable. The light wasn’t quite natural—it was a far cry from the glow of the neon signs Lyra had spent her childhood under, but it wasn’t anywhere near sunlight, either, and it gave the entire place an eerie, indescribable glow. The constant pulsating flicker of thousand-year-old holograms gave the illusion of something moving in the corner of her eye, a specter that vanished when she tried to look at it only to reappear in her peripheral vision. Maybe she was losing her mind, she thought, or maybe it was just the fact that she hadn’t slept in three days. That could be a part of it, too.
Groggily, she rubbed her eyes and struggled to keep pace with Acidalia and the android. She tried to focus on moving forward with them, but it was hard to tear her attention away from the beautiful, uncanny scenes around her. Every single piece of this place was bizarre, futuristic and ancient, as blank as Alpha-24’s stare. She didn’t know it was possible for something to be this obviously Imperial and this minimalist at the same time—there wasn’t anything here to indicate that this was a place of wealth, but there almost didn’t need to be. No statues or sculptures or expensive paintings could better match the Terminal’s aesthetic than these blank, featureless walls.
Together, they walked further and further into the complex, traversing a myriad of identical rooms and corridors. Lyra tried to keep track of where they were going, but after a while, everything seemed to blend together into a retro-futuristic, white mess. There was a spiral staircase in the middle, a massive metal structure designed to look like a double helix, and although they kept climbing ever upwards, Lyra couldn’t help but feel like she was sinking; every new level they came across felt more distant than the outside world, and it seemed like they were just going deeper and deeper until this ancient bastion of history could pull them in and drown them. Acidalia walked with disturbing confidence, and looking at her, Lyra couldn’t help but feel inferior again—out there, in Appalachia City’s dirty streets, the Imperatrix Ceasarina had felt like a person, like someone who’d struggled and gotten hurt just like Lyra had. But now they were in Acidalia’s domain, and her Imperial persona came back in full force, to the point where she barely seemed like a human anymore. She was nothing but elegant and beautiful and serene, even as her blood stained the white floors rust-red. How does she do it? Lyra wondered, and why can’t I ever copy it right?
Advertisement
After walking up the staircase for a while—how long, exactly, she couldn’t say; there were no clocks in here, and time had long since begun to feel meaningless—they abandoned the central atrium and walked left, down a neo-classical, Greco-Roman hallway filled with artwork. Dusty statues of people Lyra didn’t recognize lined the decorated walls. Beside them were tiny plaques, embossed with words in old Anglican. Isaac Newton, read one near the front, mounted beside a statue of a man with curly hair and a spinning holographic apple. The description was mostly unintelligible, but Lyra recognized gravity from her own Latin gravitas, and Principia Mathematica rung a distant bell. She’d heard of Newton before.
These were the scientists of old, she realized. Tycho Brahe, Galileo, and other figures she vaguely recalled were among the many accomplished men and women who’d been memorialized in stone here. The statues were organized by date and decorated with little holograms, which surely would have looked futuristic at the time they were built but came across as hopelessly kitschy now. Archimedes stood in the very front of the hall, covered with spheres and cylinders and wavering parabolas, flanked by Euclid and his holographic shapes and surrounded by countless other Greeks and Romans. They were all famous, the sort of people even an uneducated dancer like Lyra could recognize on sight. Even the least privileged, least intelligent Eleutherians knew of Archimedes, Einstein, the greats before the Founders, those who laid the foundation for modern technology all those eons ago. She had no idea what E=mc^2 meant, but she knew who’d invented it.
Alpha-24, oblivious, prattled on and on about Faraday and his force fields, then digressed into something about Acidalia City in Mars and hey, you’re named Acidalia, what a strange coincidence! He seemed excited about everything, looking at his surroundings with bright eyes despite the fact that he’d been here for years on end. Was he really excited? Could he really feel anything? Lyra had never met a mechanical man before.
Acidalia kept talking to Alpha, acting almost friendly to him despite her initial discomfort. But almost friendly wasn’t actually friendly—she was just being cautious, and Alpha probably didn’t realize it. Acidalia was like that. Nice, but shady and manipulative when she wanted something from someone.
Well, considering Alestra’s actions, maybe shadiness and creepiness was more of a royalty thing than an Acidalia thing.
Imperatrix Alestra Harmonia Cipher, a cold-blooded murderer. Corruption ran just as deep up there as it did down here. It was a different type of dystopia, but dystopia nonetheless. Innocent people died and children got hurt and it was all the same thing, except the people from the very top were more secretive about it. It almost made Lyra wonder what other secrets Acidalia was keeping from her, because she knew as well as everyone else did that Acidalia too was no innocent. Lyra had seen how she shot that man and hit him first try, how she’d been so quick to vengeance and callous about the death of another person. And Lyra wasn’t stupid. She knew full well what people had to do to survive, and she figured that is Alestra was truly a dangerous murderer, Acidalia might had to learned how to defend herself. Either way, Acidalia knew what she was doing. She was excellent at killing people, excellent at political games, and excellent at making herself look completely harmless.
The Imperatrix stood at the top of the double-helix staircase for a second, briefly casting her gaze over the statues of the thinkers and philosophers of old. With her hair down and her makeup untouched, she looked like someone out of an old holomovie, an action heroine. The type of girl who would kick alien ass, save the world from poorly-rendered monsters, and have a torrid affair with the main male lead that would end in a dramatic kiss at the climax. And do it all in high heels and un-smudged red lipstick.
Advertisement
She never let that mask slip, did she? Was it even a mask?
“And this is Rosalind Franklin, who took the first photograph of DNA!” Alpha-24 interjected suddenly, his voice echoing around the hallway. It wasn’t as mechanical as Andromeda’s, rather a slightly off-putting man’s voice that didn’t really sound much like a person's. It had a vaguely human lilt to it, but it still wasn’t right; he emphasized words wrong and pronounced Latin oddly, like he’d been designed for a different language.
“Mmm,” Acidalia murmured, walking down the staircase and joining him. “I’m something of a geneticist myself.”
“Maybe you’ll be here among the greats someday!” Alpha-24 said, overly enthusiastically.
Acidalia smiled, as if she was enthusiastic, too. “Maybe someday.”
There was a threshold in the center of the hall, where names of scientists suddenly became names of scientific royalty. Katerina Aurelia (her plaque read Kate Amelia Davis) stood in the center, surrounded by her peers and carved in cold marble. To Lyra’s surprise, this woman, this god who had founded Eleutheria and begun the Cipher clan, was anything but elegant. Katerina—Kate, the plaque said, Kate—appeared hardened and angry, like something had been brutally taken from her. She was scrawny, about Lyra’s size, and from what little of her body was visible, she looked practically malnourished. Marble ribs jutted out of her marble chest. Rather than a white gown the length of her whole body, she wore old, ratty, torn-up clothing—too-big pants, a lopsided tank top and a white lab coat that Lyra could tell had seen better days, even when it was carved in stone. Her hands were bandaged up and bleeding under latex gloves. On the shoulder of the lab coat, a small, rounded logo had been embroidered, but it had come unstitched. It read something in Anglican, but Lyra couldn’t tell what. She held a vial of glass and a needle with two points, and her Cipher eyes glimmered dangerously, even though she was nothing but rock. From her frizzy locks to the drop of blood on the end of her two-pronged syringe, she appeared incredibly real. If she was painted in colors instead of carved in stark white, she would have been so realistic that Lyra wouldn’t question it if she stepped off the podium and walked right up to them, brandishing that bifurcated needle.
“She doesn’t look much like me, does she?” Acidalia asked softly. “She doesn’t really look like any of the Ciphers, for that matter.”
“Not at all,” Lyra said, then wondered if she really should have voiced that.
Acidalia looked at the statue for a long moment. Kate’s eyes stared back at her, unblinking, like Alestra’s; they were the only part of her that even slightly resembled the royal family.
“American Academy of Sciences,” Acidalia said out loud, looking at the lab coat. “Infectious Disease Sector.”
“She was a Scientia?” Lyra asked. Scientias weren’t supposed to be in positions of power, formally or informally; that fell to castes Princips and Praelia and Cipher. Unless Kate had been an advisor or something of the sort, there was no way she could have gained political power—not legitimately, at least.
Acidalia paused for a second. “No,” she said. “She wasn’t a Scientia.”
“Then what was she?”
“If I’m being candid? An unsociable, disliked mutant from a backwater town in New York. There were no castes back then—she wasn’t born into power, but she wasn’t born into science, either. She started from nothing, absolutely nothing, and founded an empire. There aren’t a lot of people who can do that. Stars know I couldn’t do that.” She laughed sadly. “Half the time I can’t even run my own empire.”
“You’re standing here, covered in blood, risking your own life to stop a war,” Lyra said. “Not a lot of people would do that, either.”
“That’s different. It’s not my choice so much as it is my responsibility, is it?” Acidalia looked at Kate again, her gaze lingering on the bright eyes that looked nothing like her own, before turning back to the hall. “There are some things I just have to do.”
“Where is your empire?” Alpha-24 asked.
Lyra looked at Acidalia for a moment.
“Not far from here,” Acidalia said vaguely.
If Alpha was suspicious, he didn’t show it. “What’s it called?”
“Honestly, I’m not sure what it’s called, or even who it belongs to,” Acidalia admitted. “We’re kind of falling apart at the moment.”
“Every empire must fall,” Alpha said without a hint of fear or sadness in his tone. “Like Rome,” he added, unhelpfully.
“Just like Rome,” Acidalia sighed. “I just wish-“
The ground shifted under them suddenly, and Archimedes’s holographic parabolas jolted out of sync with one another. A cytosine tumbled off the ladder, leaving jagged, white edges behind.
“An earthquake,” Alpha said, in the exact same tone a birdwatcher might use upon spotting a particularly pretty fairywren.
“A bomb,” Acidalia corrected. “We need to hurry.”
“Bombs? We haven’t been at war for centuries!”
“Well, your knowledge is a little outdated,” Acidalia snapped. “We’re wasting time. We have to go. Alpha, which direction is the main terminal?”
“Keep walking forwards.” He looked nervous—as nervous as an only-sort-of-human android man could look, anyway. “It’s at the very center.”
Another blast rang out beneath them, sending Charles Darwin and Max Planck toppling to the ground in a cascade of marble and metal. Darwin’s holographic finches flew out into the hall before flickering into voxels and fading away. Shards of glass and gemstones from shattered statues coated the floor in a glittery sheen. Acidalia stepped delicately but quickly over the broken chunks of amethyst and quartz, followed by Lyra and Alpha, who ambled on considerably less gracefully.
How does she do that? Lyra wondered. Acidalia constantly seemed like she was a princess, even amidst this nightmare. She was running, but Lyra half-expected her to launch into a grand jeté. Lyra felt clumsy and inadequate in comparison. Then she realized that they were being bombed and she should probably stop worrying about how graceful she looked compared to someone who’d been trained to be the definition of grace since her birth.
Something crashed to the ground in front of her. She fell and found herself eye-to-eye with Louis Pasteur’s stony white face. Alpha-24 pulled her up with an artificial smile, reminiscent of a bad actor’s false happiness, and again Lyra marveled at how bizarre the entire situation was.
Acidalia whisked them through another security check, struggling to get a sample into the DNA reader amidst the chaos. The whole thing was kind of pointless, considering that only a Cipher would know enough about what she was doing to cause serious damage, anyway. Even the security checks were elaborate and beautiful—of course, they had to be, lest some member of the Imperial family find herself face-to-face with anything or anyone less than pure perfection.
Abruptly, the ground underneath them rumbled again. Acidalia went careening into a pillar. She straightened up and soldiered on, then went flying into the same pillar again as the entire building shook for the third or fourth time. Every time Lyra went to stand, something below her gave way and she toppled again. With great effort, she managed to launch herself upright, and moved once more at a snail’s pace, clinging to the ornate carvings on the wall. Momentarily, she thanked the stars that the minimalist style of a thousand years ago wasn’t used in this section; without the carvings to hold onto, she’d never have been able to stand.
“Faster, faster!” Acidalia yelled. “The ceiling’s crumbling, this section is going to collapse!” Frantically, she tried to drag herself upright again. Sharp pieces of chrome and glass tumbled from the ceiling and the statues, embedding themselves in the ground and any uncovered skin. Something tore Acidalia’s pant leg and took a chunk of flesh with it, but she barely flinched.
“I’m trying!” Lyra screamed. Something bounced off her helmet—a chunk of amethyst as large as her head. It could easily have killed her if she wasn’t wearing protective equipment. The crystals and stones of the carvings above were falling faster now, dropping like sharp, hard rain and leaving cracks in the floor.
“My head is dented!” Alpha exclaimed, sounding mildly surprised. “That will need to be fixed. Many things will need to be fixed here-“
“Move!” Acidalia pulled him over with a great clattering of metal and plastic. The space where he’d just been standing was now occupied by a chunk of marble bigger than Lyra.
“I’m confused,” Alpha said.
“So am I,” Acidalia said breathily, trying to drag herself out from underneath a pile of rubble. “Those bombs aren’t even outside of the Terminal anymore. They’re hitting us, directly. How do they know we’re here?”
“I don’t know!” Lyra exclaimed, feeling something else dent her helmet. She reached up to feel her head, and her hand came back hot and red and sticky. Something rumbled far above her, and she briefly felt Acidalia’s hand on hers before she was pulled forwards and something else collapsed almost on top of them. The unmistakable sounds of aircraft sounded throughout the room, and the whole building trembled in response to the pressure. Acidalia pulled something small and pen-shaped from her pocket, uncapped it, and jabbed in into her thigh.
“What are you doing?” Lyra shouted. “What-“
“Stim pen. Epinephrin cocktail, releases hysterical strength. I don’t like these things, but I’m not going to be at any disadvantage here.” She tossed one to Lyra, who glared at it nervously before tucking it in her pocket, unused. She’d seen what these drugs could do to people.
They continued on, Acidalia jittery from the adrenaline and Lyra a mixture of frightened and determined. The walls felt as if they were collapsing in—mostly because they were—and Lyra was claustrophobic, panicky. She could swear she heard laser bolts, but she wasn’t sure if they were borne out of paranoia and sleep deprivation, or if she really was being followed by soldiers.
Without warning, their surroundings suddenly changed from sterile, beautiful marble to something more abstract. The atmosphere became hazy from an abundance of light and mist, and the ornate carvings vanished into nothingness. It was sterile, minimal, beautifully simple, and the walls and the floor became hard to make out.
“Nos requirere sanguinus,” came a robotic voice, sounding louder than normal in the echoey chamber. “Oportet te dare sanguinem procedat.”
Acidalia rolled up one of her gloves and slit her wrist with a tiny metal knife. Drops of bright red blood fell into the floor. Something whirred, and suddenly the three of them were covered in bright white light.
“Keep your eyes open,” Acidalia said. Lyra forced her eyelids apart, squinting against the blinding whiteness. There were lights everywhere, glowing from every direction and reflecting off the mist and mirrors, shining onto prisms and glass debris. All sound seemed echoey and indistinct, and movement felt slow and difficult, like she was walking through water. Gravity seemed different here; she was both weightless and heavy somehow. Acidalia’s hair floated behind her like a waving flag, shimmering with shards of broken crystals.
“Where is this place?” Lyra asked, awestruck.
“The very center of the Terminal,” Acidalia replied breathlessly.
“Why’s it like this?”
“They keep it humid here; it has to be, for the cells to survive.” Blood dripped from Acidalia’s leg, but it seemed to fade away before it touched the ground, lost in the rising vapor. “Reality always seems a little altered in certain places. This is a liminal space—a space that’s only meant to be a temporary gateway from one thing to another.”
“Oh.” The rumbling and the shaking, the buzzing of the lights, and the constant threat of imminent death all seemed to disappear. Lyra turned skyward, and saw nothingness. In this glimmering, ethereal dimension, laser fire seemed as far away as the distant stars. “What am I supposed to do?” she asked.
“Hold this.” Acidalia waved her hand, and a rack of small, silver platters rose from the depths of the mist, sleek and silent.
“What are they?” Lyra looked at them suspiciously.
“Every file from thousands of years of human history. Don’t drop them.”
“I won’t.” Bewildered, Lyra stared down at the silver circles. They seemed much too small to hold that amount of data—not that she was an expert in computing, but the amount of files on these things had to be unimaginable. She wondered if Acidalia trusting her with these was a smart decision.
“It’s here someplace,” Acidalia muttered softly, standing over a holographic console, her face lit from the bottom in neon blue. “GCGATACGCGTCTTCTGCGGATGACTTAACACGC…”
Lyra debated whether she wanted to know what Acidalia was looking for.
“ATGGCGATTAGCTAGGTGCGCGGAT…”
“Are you okay?” she asked finally. “What do those letters mean?”
“DNA,” Acidalia said unhelpfully, rifling through folders. The holograms turned solid in her hands, becoming immovable sheets of transparent plastic, before she flicked them with her wrist and they dissipated into pixels again, nothing more than computer-generated projections. She tossed data sticks over her shoulder, unfolding them before shutting them back down again, muttering the same four letters all the while. Lyra wondered what the code meant, if it meant anything at all, and thought either Acidalia was an absolute genius who’d somehow managed to memorize all that, or a frightened young woman who had suddenly lost her mind. Based on her behavior, either was possible.
“CATCGGAGCTTAG… aha.” Acidalia held up a plastic sheet of data like it was the holy grail. “Eureka.”
The whole room lit up in fluorescent colors, glowing like something enchanted. Alpha’s pale face turned bright white under the lights, and Lyra looked at her own hands to see that her pasty skin was shimmering, droplets of iridescence flickering like fire and fading on her hands. Acidalia entered code of her own in the documents, frowning and occasionally turning to replace something in the seemingly-random letters. An A here, a C there. It was incomprehensible, but beautifully so, like it was a whole new language that Lyra was just beginning to observe.
Then, as abruptly as the blue had flashed, it vanished, and everything was throbbing, pulsing red.
“Persevero,” Acidalia whispered.
“Es certus?” the system whispered back. The robotic voice was no longer cool and feminine, but distant and alien. “Et hoc damnum illa non possit separari.” This damage cannot be reversed. Time stilled, and the air hung thick and slow.
“Non curo. Persevero.” I don’t care. Continue. Acidalia’s voice was smaller than it normally was, swallowed up by the mist.
Then it was all blue again, and time and gravity returned to whatever could be considered normal down here. The beads of sweat on Acidalia’s brow lit up in the same pastel colors as their surroundings, bright against her skin. The shards of glass glowed in contrast to her black hair, and her eyes lit up around her dark irises, making her look almost extraterrestrial, scary. Lyra looked briefly at Alpha, who seemed as bemused as she felt.
“Persevero, persevero,” Acidalia murmured. “Vade.” She bypassed what looked like a security code. The display stood above her, seemingly a thousand stories tall, making her look tiny in comparison, like she was a part of something bigger than herself.
Laser beams enveloped them all, shrouding them in blinding light for what seemed like the thousandth time. Lyra squinted again—why did all of this have to be so bright?—but the scanners didn’t want her, they wanted Acidalia. It was another security check, another confirmation that she was who she claimed to be, and then a flood of color and a distant rumble of noise. Acidalia tensed. “Someone’s here.”
“That can’t be—“ Alpha began.
“No,” she interrupted, “we’ve been followed.”
Advertisement
- In Serial6 Chapters
Descendants of the Divine
This Is the Era of GODS! This is the Era of TITANS! This is the Era of DREAMERS! This is the Era of KINGS! This is the Era to carve your name in history! This is the story of Mansa’s first time leaving his village to see the world and the series of events that would lead to him dominating an Era in history. ............ The entire story is just the first draft so there might inconsistencies and stuff like that so just please point them out when you see them. Not my image found it on google If the content owner wants me to take it down I will
8 162 - In Serial30 Chapters
Tale of Death
Shi was once an ordinary young girl living in her small village with her loving mother, life was modest but it was enjoyable. That was until one fateful day her life changed drastically. From the tragedy of her mother's death, she was born anew, her bloodline changed to no longer be human. She was special and she knew it. Follow Shi as she uses her new powers and bloodline to travel across the lands of Shinseina; hunting for the people that killed her mother. To find answers. Meet people. Gain new friends. Find love in an unlikely place. And more. ~~~~~ Hey there, this story is a rather new project I'm working on. I'm a new author, with little to no experience so I would love any feedback you may have.
8 176 - In Serial19 Chapters
Elysium
The first God, Prometheus.A being that transcended simple Godhood. He stood at the apex of power, the pinnacle of creation. But it was his might that became his downfall.His heart corrupted as his lovers and friends withered away with the passing of time. He envied them; their mortality and he thristed for it, more and more with each second.His mind and soul were thrown in an endless maelstrom of envy over his own brethren and raw madness. But before he gave into the pull of insanity he ended his own life.Overloading his own power in an explosion so massive that the fundamentals of space and time were distorted, a lone soul made its way through the cracked dimensions; bypassing nether and purgatory. Astray and confused the small wisp entered its new life.
8 101 - In Serial24 Chapters
Warwielder - Book 1 of The Evernoth Odyssey
Marschal's down on his luck.He's a remnant of a fallen empire that once spanned several conquered nations. Now he's forced to struggle through day-to-day life with too many enemies on his tail. But all that changes when a stranger offers to grant him what he wants most.But at a price.For there is a mysterious lady who's looking to embark on a mysterious quest and she needs companions to help her accomplish it. A wiser man would have refused. But beggars can't be choosers.And Marschal is about to learn that maybe not all adventures are taken by heroes.
8 182 - In Serial4 Chapters
the girl in the ramones shirt
8 133 - In Serial5 Chapters
"Something special" 45th anniversary Chuck e cheese story
Chuck had never known his own birthday and never knew why. So,one day Jasper and the rest of the gang wanted to do something special for him,Something that Chuck e will remember forever..(MY OC WILL BE FEATURED IN THIS BECAUSE IT'S AN AU)
8 71

